caracterizacion molecular de psudomona en burn 2017 y patones de resistencia antimicrobiana

Prévia do material em texto

Molecular characterization of multidrug-resistant
(MDR) Pseudomonas aeruginosa isolated in a
burn center
Keila de Ca´ssia Ferreira de Almeida Silva, Mariana Alcaˆntara Calomino,
Gabriela Deutsch, Selma Rodrigues de Castilho, Geraldo Renato de Paula,
Luciana Maria Ramires Esper, Lenise Arneiro Teixeira *
Pharmacy Faculty, Universidade Federal Fluminense, Nitero´i, RJ, Brazil
1. Introduction
Pseudomonas aeruginosa is an important microorganism in-
volved with infections in burn patients worldwide [1,2].
Infections caused by this pathogen are difficult to treat due
to high level drug-resistance, and consequently reduced
therapeutic options. In P. aeruginosa, the increasing b-lactam
resistance highlights the importance of b-lactamases-coding
genes: ESBLs (extended spectrum b-lactamases) and MBLs
(metalo b-lactamases), which are normally associated with
promiscuous mobile genetic elements (MGE) promoting
resistance spread. [3]. Other mechanisms can also be
involved in b-lactam resistance including the loss of the
outer membrane porin (OprD) and overexpression of efflux
pumps [4].
b u rn s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3
a r t i c l e i n f o
Article history:
Accepted 14 July 2016
Keywords:
Pseudomonas aeruginosa
Wound burn
Multidrug resistant
Carbapenem resistant
Biofilm
a b s t r a c t
Objective: The aim of this study was to characterize molecularly multidrug-resistant (MDR)
Pseudomonas aeruginosa isolates collected fromburn center (BC) patients and environment in
a hospital localized in Rio de Janeiro city, RJ, Brazil.
Methods: Thirty-five P. aeruginosa isolates were studied. The antimicrobial resistance was
tested by disk diffusionmethod as recommended by CLSI. The assessment of virulence (exoS
and exoU) and resistance (blaPER-1, blaCTX-M, blaOXA-10, blaGES-1, blaVIM, blaIMP, blaSPM-1, blaKPC,
blaNDM and blaSIM) genes were achieved through PCR and biofilm forming capacity was
determined using a microtiter plates based-assay, as described previously. Genotyping was
performed using Multilocus sequence typing (MLST).
Results: High rate of P. aeruginosa (71.4%; 25/35) were classified as MDR, of them 64% (16/25)
were related to clone A, the most prevalent clone found in the BC studied. A total of eight
carbapenems resistant isolates were detected; three belonging to clone A and five carrying
the exoU virulence gene. In addition, clone A isolates were also biofilm producers. Two new
sequence types (ST) were detected in this study: ST2236, grouped in to clone A; and ST2237,
classified in the different clones, displaying carbapenem resistance and exoUvirulence gene.
Conclusion: The high prevalence of biofilm producers andmultiresistant P. aeruginosa isolates
in BC indicates that prevention programs need to be implemented to avoid infection in highly
susceptible patients.
# 2016 Published by Elsevier Ltd.
* Corresponding author at: Departamento de Tecnologia Farmaceˆutica, Faculdade de Farma´cia, Universidade Federal Fluminense, Rua
Ma´rio Viana 523, Santa Rosa, Nitero´i, RJ 24241-002, Brazil. Tel.: +55 21 2629 9559; fax: +55 21 2629 9559.
E-mail addresses: tlenise@hotmail.com, lenisat@id.uff.br (L.A. Teixeira).
Available online at www.sciencedirect.com
ScienceDirect
journal homepage: www.elsevier.com/locate/burns
http://dx.doi.org/10.1016/j.burns.2016.07.002
0305-4179/# 2016 Published by Elsevier Ltd.
In Brazil, SPM-1 is the most frequent MBL described and
was associated with a single epidemic clone spread in
different regions [5]. Studies have been conducted in order
to determine the relationship between endemic clones and
their ancestors, and MLST has frequently been used as an
important tool for understanding evolutionary history, popu-
lation dynamics, and also to trace the pattern of bacterial
spread. According to Silva et al. [6], the Brazilian endemic
clone of P. aeruginosa SPM-1-producer was related to a
common ancestor (ST277). However, little is known about
the MLST population structure of P. aeruginosa in Brazil. In
Spain, a study performed by Viedma et al. [3] revealed that
most of P. aeruginosa isolates belonged to a single clone (clone
B), clustered in the ST175 and were associated with blaVIM-2
gene. Other studies in five Mediterranean countries pointed
out the ST235 as themost common P. aeruginosa ST,whichwas
associated with multidrug-resistance and presence of exoU
virulence gene [7].
Pathogenicity of P. aeruginosa is attributable to production
of several virulence factors including pyocyanin, rhamnoli-
pids, elastase, exotoxin A, phospholipase C, as well as
secretion systems, mainly Type III Secretion System (T3SS).
T3SS has been considered as amarker for P. aeruginosa isolates
associated with a poor clinical outcome [8]. This system is
thought to be responsible for the injection of at least 4 effector
proteins directly into the cytosol of eukaryotic cells: Exoen-
zyme S, Exoenzyme T, Exoenzyme Y and Exoenzyme U
encoded by the genes exoS, exoT, exoY and exoU, respectively.
exoT and exoY seems to play minor role in virulence, exoT and
exoY are present in almost all clinical isolates [9], while exoS
generaly the most prevalent and exoU are variably distributed
among the isolates [10]. Previous studies have shown that the
presence of exoS is related with increased virulence in lung
infections and burn wounds [11]. In the other hand, ExoU
protein exhibits high-level cytotoxicity to various cells lines
including epithelial, macrophages and fibroblasts [12,13]. In
addition, ExoU is strongly associatedwith acute lung epithelial
injury and septic shock [14].
The ability of P. aeruginosa to change from planktonic (free-
living cells) to biofilm form (surface-attached cells embedded
within an extracellular polymeric matrix) is an important
factor associatedwith bacterial persistence and infections [15–
17] because it can hinder the action of antimicrobial or
biocides.
The aim of this study was to determine the antimicrobial
resistance profile, assess beta-lactamase mediated resistance
and virulence genes, evaluate the capability to develop biofilm
and correlatewith the genotypes in a collection of P. aeruginosa
isolates obtained from burn patients and burn unit environ-
ment (BUE).
2. Materials and methods
2.1. Bacterial strains
Thirty-five clinical isolates of Pseudomonas aeruginosa were
collected fromwound burn patients or burn unit environment
(BUE), as balneotherapy table, at a Public Hospital in Rio de
Janeiro, Brazil, between September and December 2012. These
isolates were stored at�80 8C on Tryptic Soy Broth–TSB (Difco)
containing 20% (v/v) glycerol. Routine identification tests and
molecular typing by Pulsed Field Gel Electrophoresis (PFGE)
were performed using Spel restriction enzyme and the DNA
fragments were separated in a contour-clamped homoge-
neous-electric-field DCIII apparatus (Bio-Rad Laboratories) as
described previously [18].
2.2. Antimicrobial susceptibility test
Antimicrobial susceptibility was determined by disk diffusion
method according to the Clinical and Laboratory Standards
Institute (CLSI 2014) recommendations. The antibiotic disks
(Cecon1) used in this study were piperacillin + tazobactam
(100/10 mg), ceftazidime (30 mg), imipenem (10 mg), merope-
nem (10 mg), aztreonam (30 mg), gentamicin (10 mg), polymyxin
B (30 UI) and ciprofloxacin (5 mg). Pseudomonas aeruginosaATCC
27853 was used as control strain for this test. Multidrug-
resistant (MDR) was defined as non-susceptible to at least
three or more antimicrobial categories.
2.3. Polymerase chain reaction (PCR)
Specific primers were used in PCR-based-assays to investigate
beta-lactamase resistance genes including blaPER-1,blaCTX-M,
blaOXA-10, blaGES-1, blaVIM, blaIMP, blaSPM-1, blaKPC, blaNDM, blaSIM
and also the virulence genes exoS and exoU (Table 1).
2.4. Carba NP test
The Carba NP test was performed according to protocol
proposed by Dortet et al. [19], in order to detect carbapene-
mase production, through b-lactam ring hydrolysis of a
carbapenem, imipenem, followed by color change of a pH
indicator. All carbapenems resistant isolates were evaluated
by this test.
2.5. Biofilm formation
Biofilm development was evaluated by a colorimetric microti-
ter plate-based assay as described previously [20]. Bacterial
colonies were grown at 37 8C in TSB (Difco) for 24 h. The
bacterial suspensions were then diluted (1:100) in a new TSB
medium and 100 ml of this dilution was used to inoculate the
sterile flat-bottomed 96-well polystyrene microtiter plates
(Nunclon; Nunc). Following an incubation period of 24 h at
37 8C without shaking, wells were gently washed three times
with 100 ml of phosphate buffered saline (PBS; pH 7.4) and
stained with 100 ml of crystal violet (CV) 0.1% (w/v) for 10 min
at room temperature. Excess CVwas removed bywashing, and
biofilm was quantified by measuring the corresponding OD570
nm of the suspension of the biofilm growth in 95% ethanol. For
each isolate tested, biofilm assays were performed in
quadruplicate and the mean biofilm absorbance value was
determined. Isolates that formed biofilms �OD570 of the
positive controlwere considered positive for biofilm formation
whereas those isolates with values less than that observed for
the control were considered as non-biofilm forming strains
[21]. P. aeruginosa ATCC 27853 was used as positive control
biofilm producer.
b u r n s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3138
2.6. Multilocus sequence typing
MLST was performed in ten isolates according to the protocol
described by Curran et al. [22]. Eight of ten were carbapenem-
resistant and two susceptible, including isolates from patients
and BUE. The clone A samples carbapenem-resistant (3/5) and
susceptible (2/5) were selected as a representative sample for
this clone. The other five carbapenem-resistant isolates,
which in turn were mostly belonging to sporadic clones were
also choosen. The sequences from seven house-keeping genes
(acsA, aroE, guaA, mutL, nuoD, ppsA and trpE) were compared
with the allele sequences and ST profiles hosted in the MLST
database available at http://pubmlst.org/paeruginosa.
3. Results
The antimicrobial susceptibility test classified most of the
isolates (71.4%; 25/35) as MDR (Table 2).
Resistance to ciprofloxacin (94.3%) showed the highest rate,
followed by gentamicin (88.6%), ceftazidime and aztreonam
(57.1% and 54.3%, respectively), and carbapenem resistance
(22.9%; isolates 2, 3, 4, 5, 9, 24, 31 and 32). Six of eight
carbapenem-resistant isolates were resistant to both imipe-
nemandmeropenem (Table 2). No resistancewas observed for
piperacillin + tazobactam and polymyxin B.
PCR showed 34.3% (12/35) isolates harboring blaGES-1 gene,
while blaCTX-M gene was present in only one isolate. The genes
blaPER-1, blaOXA-10, blaVIM, blaIMP, blaSPM-1, blaKPC, blaNDMand blaSIM
were not detected. Among the carbapenem resistant isolates,
no carbapenemase producer was detected by Carba NP test.
The most frequent clone detected by PFGE, was named
clone A, which grouped 76.2% (16/21) of the MDR isolates and
47.6% (10/21) of the isolates carrying blaGES-1 gene and three
were carbapenem resistant isolates (Table 2).
Regarding the virulence genes, themost prevalent was exoS
(71.4%; 25/35); the majority of the isolates carrying exoS gene
belonged to clone A (72%). exoS and exoU were not detected in
14.3% (5/35) of the isolates. exoU virulence gene was observed
only in carbapenem-resistant isolates (14.3%; 5/35). The
capability to form biofilm was detected in 31.4% (11/35) of
the isolates andwas also associatedwith clone A (81.8%; 9/11).
Among 11 biofilm-forming isolates, 6 (54.5%) were classified as
MDR.
MLST provided two new sequence types (ST). Five isolates
(1, 3, 9, 24 and 26), which belonged to clone A (A1 and A2),
showed the same allelic profile (acsA – 9, aroE – 52, guaA – 5,
mutL – 67, nuoD – 95, ppsA – 20 and trpE – 9) and were classified
as ST2236. In addition, other five isolates (2, 4, 5, 31 and 32),
which were not related to clone A and belonged to distinct
clones were also grouped in a single allelic profile (acsA – 82,
aroE – 39, guaA – 119,mutL – 13, nuoD – 13, ppsA – 2 and trpE – 4),
and classified as ST2237.
4. Discussion
Increased spread of multidrug-resistant P. aeruginosa in
hospital environment has become a global public health
problem. This pathogen is able to accumulate different
resistance mechanisms, which allow its survival under
antibiotics and biocides action.
P. aeruginosa is known as a major colonizer of burn wound
[23], whichmay increase the risk of infections in burnpatients,
since they are immunocompromised and usually submitted to
prolonged stay hospital and invasive therapeutic procedures.
This current study shows a high percentage of MDR isolates
of P. aeruginosa collected from burn patients and BUE
(balneotherapy table),which greatly reduces treatment options.
The majority of isolates exhibited high resistance rates to
Table 1 – Primers used for detection of resistance genes and exoS and exoU virulence genes by PCR.
Target gene Primer sequence (50–30) Product size (bp) Reference
blaCTX-M F: CGCTTTGCGATGTGCAG
R: ACCGCGATATCGTTGGT
552 [47]
blaOXA-10 F: TCAACAAATCGCCAGAGAAG
R: TCCCACACCAGAAAAACCAG
276 [31]
blaPER-1 F: ATGAATGTCATTATAAAAGC
R: TTAATTTGGGCTTAGGG
927 [47]
blaGES-1 F: ATGCGCTTCATTCACGCAC
R: CTATTTGTCCGTGCTCAGG
864 [35]
blaIMP F: GTTTGAAGAAGTTAACGGGTGG
R: ATAATTTGGCGGACTTTGGC
459 [48]
blaSPM-1 F: CCTACAATCTAACGGCGACC
R: TCGCCGTGTCCAGGTATAAC
648 [49]
blaVIM F: TGGTGTTTGGTCGCATATCG
R: GAGCAAGTCTAGACCGCCCG
595 [48]
blaKPC F: ATGTCACTGTATCGCCGTCT
R: TTTTCAGAGCCTTACTGCCC
892 [50]
blaNDM F: GGTTTGGCGATCTGGTTTTC
R: CGGAATGGCTCATCACGATC
620 [31]
blaSIM F: TACAAGGGATTCGGCATCG
R: TAATGGCCTGTTCCCATGTG
570 [31]
exoS F: TCAGGTACCCGGCATTCACTACGCGG
R: TCACTGCAGGTTCGTGACGTCTTTCTTTTA
572 [1]
exoU F: CCTTAGCCATCTCAACGGTAGTC
R: GAGGGCGAAGCTGGGGAGGTA
911 [1]
b u rn s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3 139
ciprofloxacin (94.3%) and gentamicin (88.6%). Previous studies,
reported that fluoroquinolones represent the highest resistance
rate in Latin America [24,25] and the increasing resistance to
aminoglycosides has been described in other studies [26,27].
Beta-lactams are used in severe nosocomial infections due
to its broad spectrum action, including carbapenems [28], and
beta-lactamase production is the main resistancemechanism
to these antibiotics category [29–31].
P. aeruginosa carrying blaGES-1 gene was first described in
Brazil in 2002 [32] and since then it has been reported in others
studies [33,34]. The production of GES beta-lactamase has been
associated with expanded spectrum cephalosporin resistance
[35]. In this study, the prevalence of the blaGES-1 gene among
isolates is consistent with previous reports [34,36] which
demonstrate that this is one of the main ESBL genes of P.
aeruginosa isolates in Brazil and its association with resistance
to ceftazidime. In our study, 83.3% (10/12) of the isolates
harboring blaGES-1 gene were also ceftazidime resistant.
The percentage of carbapenem resistance found in P.
aeruginosa (22.9%), is concerning, since these antibiotics are
considered important to therapeutic resource for treatment of
infections caused by P. aeruginosa MDR [37]. Among eight
carbapenem-resistantisolates, six were collected from
patients treated with imipenem.
Although MBLs production is one of the most frequent
mechanisms reported in carbapenem-resistant P. aeruginosa
[38], the absence of MBLs genes and non-detection of
carbapenemase activity suggests that others carbapenem-
resistant mechanisms may be present, for example, loss of
outer membrane protein (OprD) and/or efflux pump over-
expression.
The virulence gene exoS was the most prevalent in the
isolates compared with exoU, confirming previous data [10,39].
Acute cytotoxicity toward epithelial cells and macrophages
caused by ExoU had previously been described [40,41]. The
presence of exoU gene in carbapenem-resistantMDR isolates is
of great concern due to the association of high cytotoxicity and
the very limited therapeutic options to treat these burn
patients, highly susceptible to P. aeruginosa infections. Associ-
ation between multidrug-resistance and exoU gene was
Table 2 – Antimicrobial resistance profile, frequency of resistance and virulence genes and biofilm formation from 35 P.
aeruginosa isolates from patients and burn unit environment.
Isolate Source Antimicrobial Resistance Antibiotic
Pattern
Resistance
genes
Virulence
genes
Biofilm
24 h
PFGE
Profile
1 P CAZ, ATM, GEN, CIP MDR blaGES–1 – F A1
2 P CAZ, ATM, IMP, MER,GEN, CIP MDR – exoU NF D
3 P CAZ, ATM, IMP, MER,GEN, CIP MDR blaGES–1 – NF A2
4 BUE ATM, IMP, MER,GEN, CIP MDR – exoU NF E
5 P ATM, IMP, MER,GEN, CIP MDR – exoU NF NT
6 P CAZ, ATM, GEN, CIP MDR blaGES–1 exoS NF A2
7 P CAZ, ATM, GEN, CIP MDR blaGES–1 exoS NF F
8 P ATM, GEN, CIP MDR – exoS NF A2
9 P CAZ, ATM, MER, GEN, CIP MDR blaGES–1 exoS F A2
10 P GEN, CIP non-MDR – exoS NF A5
11 P CAZ, ATM, GEN, CIP MDR – exoS F A6
12 P CAZ, ATM, GEN, CIP MDR blaGES–1 exoS F A6
13 P CAZ, ATM, GEN, CIP MDR blaGES–1 exoS NF G
14 P ATM, GEN, CIP MDR – exoS NF H
15 P CAZ, ATM, GEN, CIP MDR blaGES–1 exoS NF A1
16 P GEN, CIP non-MDR – exoS NF I
17 P GEN, CIP non-MDR – exoS NF A4
18 P CAZ, GEN, CIP MDR blaGES–1 exoS NF A4
19 P —————————————————————————— non-MDR – exoS F H
20 P CIP non-MDR – exoS F A7
21 P GEN, CIP non-MDR blaGES–1 exoS F A1
23 BUE CAZ, GEN, CIP MDR – – NF A1
24 BUE CAZ, IMP, GEN, CIP MDR – exoS NF A1
26 BUE GEN, CIP non-MDR blaGES–1 exoS F A1
27 BUE CAZ, ATM, GEN, CIP MDR blaGES–1 exoS NF A2
28 BUE CAZ, GEN, CIP MDR – exoS NF A1
29 P GEN, CIP non-MDR – – NF B
31 P ATM, IMP, MER,GEN, CIP MDR – exoU NF C
32 P ATM, IMP, MER,GEN, CIP MDR – exoU NF NT
33 P CAZ, GEN, CIP MDR – exoS F A1
34 P CAZ, ATM, GEN, CIP MDR blaCTX–M exoS F A3
35 P CAZ, ATM, GEN, CIP MDR – exoS NF A3
37 P CAZ, GEN non-MDR – exoS F F
38 BUE CIP non-MDR – – NF J
39 BUE CAZ, GEN, CIP MDR – exoS NF F
P = patient; BUE = burn unit environment. CAZ = ceftazidime; ATM = aztreonam; GEN = gentamicin; IMP = imipenem; MER = meropenem;
CIP = ciprofloxacin; ———————— = susceptible to all antimicrobial tested; MDR = multidrug resistant; non-MDR = non multidrug resistant;
– = negative; F = forming biofilm; NF = non biofilm-forming; NT = nontypeable.
b u r n s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3140
reported by Garey et al. [9]. Those authors found higher
probability of encountering exoU-carrying isolates displaying
resistance to cefepime, ceftazidime, piperacillin tazobactan,
carbapenems and gentamicin.
Biofilms promote persistence of bacteria in the environ-
ment, and also in burn wound, resulting in chronic infections
[42–44]. P. aeruginosa is described to persist from 6 h to 16
months on surfaces and its persistence was related with
humidity conditions and biofilm production [45]. Although the
percentage of biofilm-forming isolates was lower (31.4%; 11/
35) than expected, considering the high capability of P.
aeruginosa to form biofilms, most of the biofilm-producing
isolates belonged to clone A (81.8%; 9/11). Moreover, 90.9% of
the producers (10/11) harbored exoS gene. Mikkelsen et al. [46]
showed an increased exoS expression for P. aeruginosa in
biofilm growth comparedwith planktonic bacteria. These data
suggest an active role of biofilm in the P. aeruginosa virulence.
Therefore, these BC burn patients were exposed to P.
aeruginosa with possibly higher ability to disseminative and
chronic infections, able to evade the host immune response
due to biofilm development and ExoS secretion.
MLST is an important method for bacterial genotyping,
and correlation between STs versus resistance and/or
virulence have been demonstrated [3,7]. In this study, two
new STs (ST2236 and ST2237) were found. ST2236 can be
relatedwith the ST1560,whichwas detected in Rio de Janeiro,
Brazil and differs in a single allele (aroE = 8) from ST2236
(aroE = 52). The carbapenem-resistant isolates were associat-
edwith these newSTs and exoUvirulence genewas related to
ST2237 (Table 3).
In conclusion, we detected two new P. aeruginosa STs
displaying carbapenems resistance in this BUE. These STs
seems to have different virulence attributes that may
influence in their pathogenic potential: one is related with
biofilm production and the other with exoU presence.
Moreover, b-lactamase production was not the mechanism
involved in carbapenem resistance in this BC. Finally, the
association of biofilm production and presence of exoS gene
leads us to predict the persistence of these P. aeruginosa
isolates in the burn wound center and BUE.
Conflict of interest
There is no conflict of interest.
Acknowledgment
This research was supported by Coordenac¸a˜o de Aperfei-
c¸oamento de Pessoal de Nı´vel Superior (CAPES), Conselho
Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico
(CNPq) and Fundac¸a˜o Carlos Chagas de Amparo a` Pesquisa
do Estado do Rio de Janeiro (FAPERJ). We wish to thank
Professor Renata Pica˜o, PhD for Carba NP experimental
support.
r e f e r e n c e s
[1] Jabalameli F, Mirsalehian A, Khoramian B, Aligholi M,
Khoramrooz SS, Asadollahi P, et al. Evaluation of biofilm
production and characterization of genes encoding type III
secretion system among Pseudomonas aeruginosa isolated
from burn patients. Burns 2012;38:1192–7.
[2] Branski LK, Al-Mousawi A, Rivero H, Jeschke MG, Sanford
AP, Herndon DN. Emerging infections in burns. Surg Infect
(Larchmt) 2009;10:389–97.
[3] Viedma E, Juan C, Villa J, Barrado L, Orellana MA, Sanz F,
et al. VIM-2-producing multidrug-resistant Pseudomonas
aeruginosa ST 175 clone, Spain. Emerg Infect Dis
2012;18:1235–41.
[4] Ruppe´ E´, Woerther PL, Barbier F. Mechanisms of
antimicrobial resistance in Gram-negative bacilli. Ann
Intensive Care 2015;5:21. http://dx.doi.org/10.1186/s13613-
015-0061-0.
[5] Gales AC, Menezes LC, Silbert S, Sader HS. Dissemination
in distinct Brazilian regions of an epidemic carbapenem-
resistant Pseudomonas aeruginosa producing SPM metallo-
beta-lactamase. J Antimicrob Chemother 2003;
52:699–702.
[6] Silva FM, Carmo MS, Silbert S, Gales AC. SPM-1-producing
Pseudomonas aeruginosa: analysis of the ancestor
relationship using multilocus sequence typing, pulsed-field
gel electrophoresis, and automated ribotyping. Microb Drug
Resist 2011;17:215–20.
[7] Maaˆtallah M, Cheriaa J, Backhrouf A, Iversen A,
Grundmann H, Do T, et al. Population structure of
Pseudomonas aeruginosa from five mediterranean countries:
evidence for frequent recombination and epidemic
occurrence of CC235. PLoS ONE 2011;6:e25617.
[8] El-Solh AA, Hattemer A, Hauser AR, Alhajhusain A, Vora H.
Clinical outcomes of type III Pseudomonas aeruginosa
bacteremia. Crit Care Med 2012;40:1157–63.
Table 3 – STs of 10 P. aeruginosa isolates associated with PFGE profile, biofilm production, virulence genes and
carbapenems resistance.
Isolate Source MLST PFGE Biofilm Virulence gene Carbapenems resistance1 P A1 F Non-detected No
3 P A2 NF Non-detected Yes
9 P ST2236 A2 F exoS Yes
24 BUE A1 NF exoS Yes
26 BUE A1 F exoS No
2 P D NF exoU Yes
4 BUE E NF exoU Yes
5 P ST2237 NT NF exoU Yes
31 P C NF exoU Yes
32 P NT NF exoU Yes
P = patient; BUE = burn unit environment; NT = nontypeable; F = biofilm-forming; NF = non biofilm-forming.
b u rn s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3 141
[9] Garey KW, Vo QP, Larocco MT, Gentry LO, Tam VH.
Prevalence of type III secretion protein exoenzymes and
antimicrobial susceptibility patterns from bloodstream
isolates of patients with Pseudomonas aeruginosa
bacteremia. J Chemother 2008;20:714–20.
[10] Agnello M, Wong-Beringer A. Differentiation in quinolone
resistance by virulence genotype in Pseudomonas aeruginosa.
PLoS ONE 2012;7:e42973. http://dx.doi.org/10.1371/
journal.pone.0042973.
[11] Bjorn MJ, Pavlovskis OR, Thompson MR, Iglewski BH.
Production of exoenzyme S during Pseudomonas aeruginosa
infections of burned mice. Infect Immun 1979;24:837–42.
[12] Schulert GS, Feltman H, Rabin SD, Martin CG, Battle SE,
Rello J, et al. Secretion of the toxin ExoU is a marker for
highly virulent Pseudomonas aeruginosa isolates obtained
from patients with hospital-acquired pneumonia. J Infect
Dis 2003;188:1695–706.
[13] Hauser AR, Cobb E, Bodi M, Mariscal D, Valle´s J, Engel JN,
et al. Type III protein secretion is associated with poor
clinical outcomes in patients with ventilator-associated
pneumonia caused by Pseudomonas aeruginosa. Crit Care
Med 2002;30:521–8.
[14] Kurahashi K, Kajikawa O, Sawa T, Ohara M, Gropper MA,
Frank DW, et al. Pathogenesis of septic shock in
Pseudomonas aeruginosa pneumonia. J Clin Invest
1999;104:743–50.
[15] Goodman AL, Kulasekara B, Rietsch A, Boyd D, Smith RS,
Lorry S. A signaling network reciprocally regulates genes
associated with acute infection and chronic persistence in
Pseudomonas aeruginosa. Dev Cell 2004;7:745–54.
[16] Ventre I, Goodman AL, Vallet-Gely I, Vasseur P, Soscia C,
Molin S, et al. Multiple sensors control reciprocal
expression of Pseudomonas aeruginosa regulatory RNA and
virulence genes. Proc Natl Acad Sci U S A 2006;103:171–6.
[17] Laskowski MA, Kazmierczak BI. Mutational analysis of
RetS, an unusual sensor kinase-response regulator hybrid
required for Pseudomonas aeruginosa virulence. Infect
Immun 2006;74:4462–73.
[18] Deutsch G, Bokehi LC, Silva AE, Guimara˜es LMJ, Rodrigues
R, Esper LMR, et al. Balneotherapy is a potential risk factor
for Pseudomonas aeruginosa colonization. Braz J Pharm Sci
2016;52:125–32.
[19] Dortet L, Poirel L, Nordmann P. Rapid detection of
carbapenemase-producing Pseudomonas spp.. J Clin
Microbiol 2012;50:3773–6.
[20] Merrit JH, Kadouri DE, O’toole GA. Growing and analysing
static biofilms. Curr Protoc Microbiol 2011. 1B.1.1–1B.1.18.
[21] Sanchez CJJR, Mende K, Beckius ML, Akers KS, Romano DR,
Wenke JC, et al. Biofilm formation by clinical isolates and
the implications in chronic infections. BMC Infect Dis
2013;13:1–12.
[22] Curran B, Jonas D, Grundmann H, Pitt T, Dowson CG.
Development of a multilocus sequence typing scheme for
the opportunistic pathogen Pseudomonas aeruginosa. J Clin
Microbiol 2004;42:5644–9.
[23] Emami A, Bazargani A, Mohammadi AA, Zardosht M, Seyed
Jafari SM. Detection of blaPER-1 & blaOxa10 among imipenem
resistant isolates of Pseudomonas aeruginosa isolated from
burn patients hospitalized in Shiraz Burn Hospital. Iran J
Microbiol 2015;7:7–11.
[24] Andrade D, Leopoldo VC, Haas VJ. Ocorreˆncia de bacte´rias
multirresistentes em um centro de Terapia Intensiva de
Hospital brasileiro de emergeˆncias. Rev Bras Ter Intensiva
2006;18:27–33.
[25] Sader HS, Gales AC, Pfaller MA, Mendes RE, Zoccoli C, Barth
A, et al. Pathogen frequency and resistance patterns in
Brazilian hospitals: summary of results from three years of
the SENTRY Antimicrobial Surveillance Program. Braz J
Infect Dis 2001;5:200–14.
[26] Hermes DM, Pitt CP, Lutz L, Teixeira AB, Ribeiro VB, Netto B,
et al. Evaluation of heteroresistance to polymyxin B among
carbapenem-susceptible and -resistant Pseudomonas
aeruginosa. J Med Microbiol 2013;62:1184–9.
[27] Yayan J, Ghebremedin B, Rasche K. Antibiotic resistance of
Pseudomonas aeruginosa in pneumonia at a single university
hospital center in Germany over a 10-year period. PLOS
ONE 2015;10:e0139836.
[28] Bertoncheli CM, Ho¨rner R. Uma revisa˜o sobre metalo-b-
lactamases. Braz J Pharm Sci 2008;44:577–99.
[29] Jacoby GA, Munoz-Price LS. The new b-lactamases. N Engl J
Med 2005;352:380–91.
[30] Lucena A, Dalla CLM, Nogueira KS, Matos AP, Gales AC,
Paganini MC, et al. Nosocomial infections with metallo-
beta-lactamase-producing Pseudomonas aeruginosa:
molecular epidemiology, risk factors, clinical features and
outcomes. J Hosp Infect 2014;87:234–40.
[31] Farshadzadeh Z, Khosravi AD, Alavi SM, Parhizqari N,
Hoveizavi H. Spread of extended-spectrum b-lactamase
genes of bla OXA-10, bla PER-1 and bla CTX-M in Pseudomonas
aeruginosa strains isolated from burn patients. Burns
2014;40:1575–80.
[32] Pica˜o RC, Gales AC. b-Lactamases de espectro ampliado
(ESBL) em Pseudomonas aeruginosa: pesadelo ou so´
imaginac¸a˜o. Prat Hosp 2007;49:79–84.
[33] Pellegrino FL, Netto-dos Santos KR, Riley LW, Moreira BM.
blaGES carrying Pseudomonas aeruginosa isolates from a
public hospital in Rio de Janeiro, Brazil. Braz J Infect Dis
2006;10:251–3.
[34] Pica˜o RC, Poirel L, Gales AC, Nordmann P. Diversity of beta-
lactamases produced by ceftazidime-resistant
Pseudomonas aeruginosa isolates causing bloodstream
infections in Brazil. Antimicrob Agents Chemother
2009;53:3908–13.
[35] Poirel L, Thomas IL, Naas T, Karim A, Nordmann P.
Biochemical sequence analyses of GES-1, a novel class A
extended-spectrum betalactamase, and the class 1
integron In52 from Klebsiella pneumoniae. Antimicrob Agents
Chemother 2000;44:622–32.
[36] Polotto M, Casella T, Oliveira MGL, Ru´bio FG, Nogueira ML,
Almeida MTG. Detection of P. aeruginosa harboring blaCTX-
M-2, blaGES-1 and blaGES-5, blaIMP-1 and blaSPM-1
causing infections in Brazilian tertiary-care hospital. BMC
Infect Dis 2012;12:1–8.
[37] Saavedra SY, Duarte C, Gonzalez MN, Realpe ME.
Characterization of isolates of carbapenemase-producing
Pseudomonas aeruginosa from seven Colombian provinces.
Biome´dica 2014;34:217–23.
[38] Rizek C, Fu L, Santos LC, Leite G, Ramos J, Rossi F, et al.
Characterization of carbapenem-resistant Pseudomonas
aeruginosa clinical isolates, carrying multiple genes coding
for this antibiotic resistance. Ann Clin Microbiol
Antimicrob 2014;1:3. http://dx.doi.org/10.1186/s12941-014-
0043-3.
[39] Feltman H, Schulert G, Khan S, Jain M, Peterson L, Hauser
AR. Prevalence of type III secretion genes in clinical and
environmental isolates of Pseudomonas aeruginosa.
Microbiology 2001;147(Pt 10):2659–69.
[40] Fin-Barbanc¸on V, Goranson J, Zhu L, Sawa T, Wiener-
Kronish JP, Fleiszig SMJ, et al. ExoU expression by
Pseudomonas aeruginosa correlates with acute
cytotoxicity and epithelial injury. Mol Microbiol
1997;25:547–57.
[41] Hauser AR, Engel JN. Pseudomonas aeruginosa induces
secretion mediated apoptosis of macrophages and
epithelial cells. Infect Immun 1999;67:5530–7.
[42] Hall-Stoodley L, Costerton JW, Stoodley P. Bacterial
biofilms: from the natural environment to infectious
diseases. Nat Rev Microbiol 2004;2:95–108.
b u r n s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3142
[43] Costerton JW, Stewart PS, Greenberg EP. Bacterial biofilms:
a common cause of persistent infections. Science
1999;284:1318–22.[44] Flynn KM, Dowella G, Johnson TM, Koestler BJ, Waters CM,
Cooper VS. The evolution of ecological diversity in biofilms
of Pseudomonas aeruginosa by altered cyclic diguanylate
signaling. J Bacteriol 2016. http://dx.doi.org/10.1128/
JB.00048-16.
[45] de Abreu PM, Farı´as PG, Paiva GS, Almeida AM, Morais PV.
Persistence of microbial communities including
Pseudomonas aeruginosa in a hospital environment: a
potential health hazard. BMC Microbiol 2014;14:118.
[46] Mikkelsen H, Bond NJ, Skindersoe ME, Giviskov M, Lilley KS,
Welch M. Biofilms and type III secretion are not mutually
exclusive in Pseudomonas aeruginosa. Microbiology
2009;155:687–98.
[47] Neyestanaki DK, Mirsalehian A, Rezaqholizadeh F, Jabalameli
F, Taherikalani M, Emaneini M. Determination of extended
spectrum beta-lactamases, metallo-beta-lactamases and
AmpC-beta-lactamases among carbapenem resistant
Pseudomonas aeruginosa isolated from burn patients. Burns
2014;40:1556–61.
[48] Aghamiri S, Amirmozafari N, Mehrabadi JF, Fouladtan B,
Kafil HS. Antibiotic resistance pattern and evaluation of
metallo-beta lactamase genes including bla-IMP and bla-
VIM types in Pseudomonas aeruginosa isolated from patients
in Tehran hospitals. ISRN Microbiol 2014;2014:1–6.
[49] Toleman MA, Simm AM, Murphy TA, Gales AC,
Biedenbach DJ, Jones RN, et al. Molecular characterization
of SPM-1, a novel metallo-beta-lactamase isolated in Latin
America: report from the SENTRY antimicrobial
surveillance programme. J Antimicrob Chemother
2002;50:673–9.
[50] Bradford PA, Bratu C, Urban C, Visalli M, Mariano N,
Landman D, et al. Emergence of carbapenem-resistant
Klebsiella species possessing the class A carbanem
hydrolyzing KPC-2 and Inhibithor-resitant TEM30 b-
lactamases in New York. Clin Infect Dis 2004;39:55–60.
b u rn s 4 3 ( 2 0 1 7 ) 1 3 7 – 1 4 3 143
	Molecular characterization of multidrug-resistant (MDR) Pseudomonas aeruginosa isolated in a burn™center
	1 Introduction
	2 Materials and methods
	2.1 Bacterial strains
	2.2 Antimicrobial susceptibility test
	2.3 Polymerase chain reaction (PCR)
	2.4 Carba NP test
	2.5 Biofilm formation
	2.6 Multilocus sequence typing
	3 Results
	4 Discussion
	Conflict of interest
	Acknowledgment
	References